MISSION® 3′UTR Lenti GoClone™

Name MISSION® 3′UTR Lenti GoClone™
Supplier Sigma-Aldrich
Catalog HUTR02402
Category miRNA
Prices $350.00
Sizes hutr02402
Gene PLCG2
Sequence GAGAAGAGAGTCAGCAACAGCAAGTTTTACTCATAGAAGCTGGGGTATGTGTGTAAGGGTATTGTGTGTGTGCGCATGTGTGTTTGCATGTAGGAGAACGTGCCCTATTCACACTCTGGGAAGACGCTAATCTGTGACATCTTTTCTTCAAGCCTGCCATCAAGGACATTTCTTAAGACCCAACTGGCATGAGTTGGGGTAATTTCCTATTATTTTCATCTTGGACAACTTTCTTAACTTATATTCTTTATAGAG (3′UTR sequences are truncated after the first 255 bases)
Supplier Page Shop

Product References

The miR-17-92 microRNA cluster regulates multiple components of the TGF-beta - The miR-17-92 microRNA cluster regulates multiple components of the TGF-beta

Mestdagh P, Bostrom AK, Impens F, Fredlund E, Van Peer G, De Antonellis P, von Stedingk K, Ghesquiere B, Schulte S, Dews M, Thomas-Tikhonenko A, Schulte JH, Zollo M, Schramm A, Gevaert K, Axelson H, Speleman F, Vandesompele J. Mol Cell. 2010 Dec 10;40(5):762-73.

GIP increases human adipocyte LPL expression through CREB and TORC2-mediated - GIP increases human adipocyte LPL expression through CREB and TORC2-mediated

Kim SJ, Nian C, McIntosh CH. J Lipid Res. 2010 Nov;51(11):3145-57.

Two-tiered approach identifies a network of cancer and liver disease-related - Two-tiered approach identifies a network of cancer and liver disease-related

Boutz DR, Collins PJ, Suresh U, Lu M, Ramirez CM, Fernandez-Hernando C, Huang Y, Abreu Rde S, Le SY, Shapiro BA, Liu AM, Luk JM, Aldred SF, Trinklein ND, Marcotte EM, Penalva LO. J Biol Chem. 2011 May 20;286(20):18066-78.

Suppression of latent transforming growth factor (TGF)-beta1 restores growth - Suppression of latent transforming growth factor (TGF)-beta1 restores growth

Dogar AM, Towbin H, Hall J. J Biol Chem. 2011 May 6;286(18):16447-58.

Dickkopf-3 is regulated by the MYCN-induced miR-17-92 cluster in neuroblastoma. - Dickkopf-3 is regulated by the MYCN-induced miR-17-92 cluster in neuroblastoma.

De Brouwer S, Mestdagh P, Lambertz I, Pattyn F, De Paepe A, Westermann F, Schroeder C, Schulte JH, Schramm A, De Preter K, Vandesompele J, Speleman F. Int J Cancer. 2012 Jun 1;130(11):2591-8.

The mitochondrial ATPase inhibitory factor 1 triggers a ROS-mediated retrograde - The mitochondrial ATPase inhibitory factor 1 triggers a ROS-mediated retrograde

Formentini L, Sanchez-Arago M, Sanchez-Cenizo L, Cuezva JM. Mol Cell. 2012 Mar 30;45(6):731-42.

The ENCODE (ENCyclopedia Of DNA Elements) Project. - The ENCODE (ENCyclopedia Of DNA Elements) Project.

. Science. 2004 Oct 22;306(5696):636-40.

Distinct microRNA alterations characterize high- and low-grade bladder cancer. - Distinct microRNA alterations characterize high- and low-grade bladder cancer.

Catto JW, Miah S, Owen HC, Bryant H, Myers K, Dudziec E, Larre S, Milo M, Rehman I, Rosario DJ, Di Martino E, Knowles MA, Meuth M, Harris AL, Hamdy FC. Cancer Res. 2009 Nov 1;69(21):8472-81.

Deregulation of microRNA-503 contributes to diabetes mellitus-induced impairment - Deregulation of microRNA-503 contributes to diabetes mellitus-induced impairment

Caporali A, Meloni M, Vollenkle C, Bonci D, Sala-Newby GB, Addis R, Spinetti G, Losa S, Masson R, Baker AH, Agami R, le Sage C, Condorelli G, Madeddu P, Martelli F, Emanueli C. Circulation. 2011 Jan 25;123(3):282-91.

The neuroimmune guidance cue netrin-1 promotes atherosclerosis by inhibiting the - The neuroimmune guidance cue netrin-1 promotes atherosclerosis by inhibiting the

van Gils JM, Derby MC, Fernandes LR, Ramkhelawon B, Ray TD, Rayner KJ, Parathath S, Distel E, Feig JL, Alvarez-Leite JI, Rayner AJ, McDonald TO, O'Brien KD, Stuart LM, Fisher EA, Lacy-Hulbert A, Moore KJ. Nat Immunol. 2012 Jan 8;13(2):136-43.